Zmiešaný

Rhodiola amabilis

Rhodiola amabilis


Vedecké meno

Rhodiola amabilis (H. Ohba) H. Ohba

Synonymá

Sedum amabile

Vedecká klasifikácia

Rodina: Crassulaceae
Rod: Rhodiola

Popis

Rhodiola amabilis je pôvabný vždyzelený sukulent, vysoký až 4 palce (10 cm), ktorý tvorí voľne hrču s centrálnym rozvetveným kaudexom. Listy sú jasne zelené, eliptické, dlhé až 0,3 palca (7 mm) a sú usporiadané do ružičiek. Stonky kvetov sú dlhé až 5 palcov a nesú jeden až niekoľko bielych kvetov až do priemeru 2 palcov.

Ako rásť a starať sa

Pri pestovaní Rozchodník, majte na pamäti, že Rozchodník rastliny potrebujú veľmi malú pozornosť alebo starostlivosť. Budú sa im dariť v podmienkach, v ktorých sa darí mnohým iným rastlinám, ale rovnako dobre sa im darí aj v menej pohostinných oblastiach. Sú ideálne pre tú časť vášho dvora, kde je príliš veľa slnka alebo málo vody, aby ste mohli pestovať čokoľvek iné. Bežný názov pre Rozchodník je Rozchodník, kvôli tomu, že mnoho záhradníkov vtipkuje, že iba kameňom je potrebné venovať menšiu starostlivosť a žiť dlhšie.

Rozchodník sa ľahko vysádza. Pri kratších odrodách stačí na to, aby ste rastlinu jednoducho položili na zem, kde ju chcete pestovať Rozchodník začala tam rastlina. Budú vysielať korene odkiaľkoľvek, kde sa stonka dotýka zeme a samotných koreňov. Ak sa chcete ďalej ubezpečiť, že tam rastlina začne, môžete nad ňu pridať veľmi tenkú vrstvu pôdy. Pre vyšších Rozchodník odrody, môžete jednu zo stoniek odlomiť a zatlačiť do zeme, kde by ste ju chceli pestovať. Stonka zakorení veľmi ľahko a nová rastlina sa založí za sezónu alebo za dve ... - Viac sa dozviete na stránke: Ako rásť a starať sa o rozchodník.

Pôvod

Pochádza z Nepálu a Kašmíru.

Odkazy

SPÄŤ NA rod Rhodiola
SUCCULENTOPEDIA: Prehliadajte sukulenty podľa rodu, čeľade, vedeckého mena, bežného mena, pôvodu alebo kaktusov podľa rodu

Fotogaléria


Prihláste sa teraz na odber a buďte informovaní o našich posledných správach a aktualizáciách.





METÓDY A VÝSLEDKY

Stôl 1.

Genetická rozmanitosť v ôsmich Rhodiola populácie založené na 17 mikrosatelitných lokusoch. a

LocusR. crenulataR. sacraR. fastigiataR. bupleuroides
RC1 (N = 24)RC2 (N = 24)RS1 (N = 24)RS2 (N = 24)RF1 (N = 24)RF2 (N = 24)RB1 (N = 24)RB2 (N = 24)
AHoHeFAHoHeFAHoHeFAHoHeFAHoHeFAHoHeFAHoHeFAHoHeF
RS130.8750.518 * −0.68840.4290.480 * 0.10630.0420.119 * 0.6520.0430.043−0.0221400.238 * 1500.361 * 1200.080 * 1
Rs270.750.747−0.00350.7080.699 * −0.01450.2080.2620.20550.2170.4930.559410.576 * −0.73540.6090.472−0.29150.2080.194−0.07160.50.587 * 0.148
Rs380.3040.737 * 0.58790.1110.867 * 0.872300.156 * 130.0830.594 * 0.8630.2080.536 * 0.61180.2080.609 * 0.658110.0420.829 * 0.95100.1670.847 * 0.803
Rs4100.8330.757 * −0.101120.6670.8220.18950.3330.359 * 0.0750.8750.683 * −0.28150.750.635 * −0.18270.9170.752 * −0.219120.2920.661 * 0.55950.2080.497 * 0.581
Rs5200.091 * 11200.5160.1110.753 * 0.85270.5710.709 * 0.19450.30.665 * 0.54930.3330.542 * 0.385300.500 * 1
Rs640.10.685 * 0.85480.10.804 * 0.87630.0430.124 * 0.64980.0590.839 * 0.9340.050.414 * 0.87950.870.681 * −0.276110.1250.891 * 0.86600.813 * 1
Rs730.50.5460.08440.1670.594 * 0.71930.0420.119 * 0.6540.4780.585 * 0.18330.0830.081−0.03240.4170.677 * 0.38520.1250.2490.49830.3330.601 * 0.445
Rs860.0910.645 * 0.85990.3330.734 * 0.546400.358 * 190.250.593 * 0.57870.1670.444 * 0.62480.3040.660 * 0.53980.2270.826 * 0.72550.0830.298 * 0.72
Rs9200.278111200.153 * 1400.691 * 1200.198 * 1400.475 * 1300.480 * 1
Rs1070.3330.4790.30430.0870.084−0.03480.4580.4840.05280.750.753 * 0.00350.8330.633 * −0.31760.7920.678−0.16850.6960.513−0.355110.5830.803 * 0.274
Rs1190.750.8280.09490.5830.849 * 0.31380.5420.804 * 0.32690.9170.661 * −0.38690.4580.857 * 0.46570.1670.578 * 0.71270.2080.658 * 0.68350.0420.296 * 0.859
Rs1230.1670.352 * 0.52640.2080.381 * 0.45330.1250.442 * 0.71740.5420.610.11280.250.505 * 0.50590.0830.566 * 0.85350.2920.4640.37180.2080.679 * 0.693
Rs1340.1250.2890.56890.4290.705 * 0.39290.750.746−0.00640.7920.553 * −0.43290.6670.780 * 0.14690.4550.689 * 0.3440.0870.306 * 0.716120.3910.758 * 0.484
Rs1420.0830.08−0.04370.4170.772 * 0.4650.3330.580 * 0.42540.7080.644−0.140.6670.568−0.17470.50.710.29640.4580.6070.24580.4580.713 * 0.357
Rs1520.0420.041−0.02130.1250.414 * 0.69820.0420.041−0.02120.4580.353−0.29730.7920.588 * −0.34730.0830.258 * 0.67730.1670.2580.35440.130.271 * 0.519
Rs1630.0870.1620.46250.0450.650 * 0.93300.405 * 130.4350.5530.21440.250.659 * 0.6240.1110.539 * 0.79430.050.141 * 0.64630.0950.177 * 0.462
Rs1770.0480.804 * 0.94170.050.786 * 0.93670.0950.680 * 0.86400.525 * 180.250.723 * 0.65480.3640.851 * 0.57370.1110.821 * 0.865120.5450.8930.389
Zlý4.8240.2990.4730.3785.8820.2620.5670.4384.3530.1770.3630.5054.8240.3950.5520.2815.1760.4120.5530.235.8820.3630.5780.4375.8240.2010.5170.5556.2350.220.5470.631

Poznámka: A = stredný počet alel na miesto F = index fixácie He = očakávaná heterozygotnosť Ho = pozorovaná heterozygotnosť N = veľkosť vzorky.

Páry primérov sa syntetizovali pre 66 mikrosatelitných sekvencií obsahujúcich opakovanú oblasť 20 - 24 báz a pôvodne sa skrínovali pomocou štyroch vzoriek z každej Rhodiola druhov. Po optimalizácii PCR, vrátane gradientovej PCR na testovanie teploty žíhania a zmeny podielu reagencií, 17 (25,8%) týchto lokusov vygenerovalo stabilné a jasné pásy s nezávislými teplotami žíhania (tabuľka 2). 17 lokusov sa potom testovalo so 192 vzorkami DNA z dvoch populácií Rhodiola druhov (tabuľka 1). Optimalizačné amplifikácie sa uskutočnili v konečnom objeme 10 μL, vrátane ~ 20 ng genómovej DNA, 6,5 μL dvakrát destilovanej vody, 1 μL 10 × Taq reakčný tlmivý roztok, 0,8 μL dNTP, 0,8 μL Mg 2+, 0,25 μl priame priméry, 0,25 μL reverzné priméry a 0,05 μL 0,5 U / μL Taq DNA polymeráza. Termocykler Biometra sa použil za nasledujúcich podmienok cyklovania: 94 ° C počas 5 minút 35 cyklov pri 94 ° C počas 40 s, 55 - 57,8 ° C (v závislosti od markera, pozri tabuľku 1) po dobu 30 s, a 72 ° C po dobu 40 s s a posledný krok predĺženia pri 72 ° C po dobu 10 min. Produkty PCR sa separovali na genotype kapilárnej elektroforézy (Majorbio Bio-pharm, Šanghaj, Čína). Oddelené SSR fragmenty sa skúmali a hodnotili pomocou GeneMapper verzie 3.7 (Applied Biosystems). Štandardné metriky populačnej genetiky boli vypočítané pomocou GenAlEx 6.4 (Peakall a Smouse, 2006).

Tabuľka 2.

Vlastnosti 17 mikrosatelitných primérov vyvinutých v roku 2006 Rhodiola.

LocusSekvencie primérov (5′ – 3 ′)Opakovaný motívTa (° C)Veľkosť alely (bp)GenBank prístupové č.
RS1F: TTGGGCGGATTGTTCCTGTT(TGA)355181–223 <"type": "entrez-nukleotide", "attrs": <"text": "JQ857096", "term_id": "383511661", "term_text": "JQ857096" >> JQ857096
R: TCCACCCTTCATCTCCTTCA
Rs2F: GCACGATGACAATTTATACGA(TCC)455134–224 <"type": "entrez-nukleotide", "attrs": <"text": "JQ857092", "term_id": "383511657", "term_text": "JQ857092" >> JQ857092
R: GGTTAGGGTTTGGAGGTGAC
Rs3F: TTCCAAATAAGCCAATCCTC(CAA)455183–288 <"type": "entrez-nukleotide", "attrs": <"text": "JQ857095", "term_id": "383511660", "term_text": "JQ857095" >> JQ85709595
R: TGTGCAACTGTAACCATCGA
Rs4F: ACCCTTCATCTTGTCCCTCA(CT)855119–150 <"type": "entrez-nukleotide", "attrs": <"text": "JQ857089", "term_id": "383511654", "term_text": "JQ857089" >> JQ857089
R: CACCCTTTTCTGTCCCACTC
Rs5F: GGAGGAAGAACTTCCCATTT(SCS)455163–239 <"type": "entrez-nukleotide", "attrs": <"text": "JQ857082", "term_id": "383511647", "term_text": "JQ857082" >> JQ857082
R: GTGGTGGTGATTGCTTTGAT
Rs6F: GAGTCAGGTGGTGGAGAATG(AGG)455157–262 <"type": "entrez-nukleotide", "attrs": <"text": "JQ857094", "term_id": "383511659", "term_text": "JQ857094" >> JQ857094
R: CAAAAGATTAGAAACTCAAAACG
Rs7F: TTGTGGACTTTGTGGGACTC(GTT)557.8262–277 <"type": "entrez-nukleotide", "attrs": <"text": "JQ857087", "term_id": "383511652", "term_text": "JQ857087" >> JQ857087
R: TGGATAAATTGCTGCCTGAC
Rs8F: CTGACGCTGAAGCAGTTGAT(TGC)557.8131–206 <"type": "entrez-nukleotide", "attrs": <"text": "JQ857085", "term_id": "383511650", "term_text": "JQ857085" >> JQ857085
R: CCCAATGGAGGACCGATGAT
Rs9F: CTTCATCATTTACATCTTGCTC(SCS)655177–204 <"type": "entrez-nukleotide", "attrs": <"text": "JQ857084", "term_id": "383511649", "term_text": "JQ857084" >> JQ857084
R: TTTTGTTACTTGACTGTGGC
Rs10F: TGCGTCAAACGGATCAAACC(CAG)455117–186 <"type": "entrez-nukleotide", "attrs": <"text": "JQ857088", "term_id": "383511653", "term_text": "JQ857088" >> JQ857088
R: TCGCTCAGCCCCTTCTCAAT
Rs11F: GTTGTTGCTTAGGCTGCTGT(GCT)455265–313 <"type": "entrez-nucleotide", "attrs": <"text": "JQ857097", "term_id": "383511662", "term_text": "JQ857097" >> JQ85709797
R: AACTTCTATGGAAATGTGGC
Rs12F: AAAAGACAGTATAGCCTCACC(TCA)455112–148 <"type": "entrez-nukleotide", "attrs": <"text": "JQ857091", "term_id": "383511656", "term_text": "JQ857091" >> JQ857091
R: TGTAGACTGATGCTGCTGAT
Rs13F: GAATAAGGTGGCTGGAGGTT(GGA)555156–234 <"type": "entrez-nukleotide", "attrs": <"text": "JQ857089", "term_id": "383511654", "term_text": "JQ857089" >> JQ857089
R: GATGAGGGACAAGATGAAGG
Rs14F: CAGAAGCGGATTCCTCATCA(AGG)455140–200 <"type": "entrez-nukleotide", "attrs": <"text": "JQ857083", "term_id": "383511648", "term_text": "JQ857083" >> JQ857083
R: CGAATCACCCGTAACCCTAA
Rs15F: CCACAGAAGCGAGTCAGGTT(GCATCA)555146–164 <"type": "entrez-nukleotide", "attrs": <"text": "JQ857090", "term_id": "383511655", "term_text": "JQ857090" >> JQ85709090
R: GTCCCGGCAAATACAAAAGT
Rs16F: AACAAGGCAGAGTCGAGAAA(GCA)455116–173 <"type": "entrez-nucleotide", "attrs": <"text": "JQ857086", "term_id": "383511651", "term_text": "JQ857086" >> JQ857086
R: CATCTTTGAACCCTAATCCA
Rs17F: ATTCTTCATCTCAGCCGTCC(GA)855126–310 <"type": "entrez-nukleotide", "attrs": <"text": "JQ857093", "term_id": "383511658", "term_text": "JQ857093" >> JQ857093
R: CACAGCCATTAGAGCCAACT

Poznámka: Ta = optimálna teplota žíhania.

Vo všetkých populáciách štyroch ľudí Rhodiola druhov, počet alel na polymorfný lokus (A) sa pohybovala od jednej do 12 (tabuľka 1). Pre polymorfné lokusy boli priemerné hodnoty pozorovaných (Ho) a očakávaná heterozygotnosť (He) kolísali od 0,177 do 0,412, respektíve od 0,363 do 0,578. Fixačný index (F) bola vysoko variabilná medzi lokusmi v každej populácii (tabuľka 1), spriemerovaná cez lokusy pre každý druh, pohybovala sa v rozmedzí od 0,230 do 0,631, čo je v súlade so zmiešaným systémom párenia v Rhodiola. Medzi 17 analyzovanými lokusmi vykazovalo osem až 16 lokusov významnú odchýlku od Hardyho-Weinbergovej rovnováhy na základe sekvenčného Bonferroniho testu (tabuľka 1), čo môže odrážať prítomnosť nezistených nulových alel alebo odchýlku od rovnovážnych podmienok ideálnej populácie.


Priemerná veľká záhrada so skleníkmi. Väčšina rastlín v kvetináčoch, niektoré v kvetináčoch na vyvýšených záhonoch. Odrezky zadarmo.

Od appt a oficiálny deň otvorených dverí.

NC na Wansbeck Estate, Stakeford, 3,2 km od A189, 4,8 km od A1.

    Psy povolené na vôdzkách WC Osvieženie občerstvenia Parkovacie rozhovory

Naši partneri

Zachovanie rozmanitosti záhradných rastlín

O nás

Zachovanie

Národné zbierky rastlín

Ako môžeš pomôcť

Diania

Miestne skupiny

Plant Heritage, 12 Home Farm, Loseley Park, Guildford, Surrey GU3 1HS | Tel: 01483 447540

© Plant Heritage 2021. Reg. charita č. 1004009 / SCO41785. IČO 2222953

Táto webová stránka používa súbory cookie, aby zabezpečila čo najlepšiu skúsenosť s našou webovou stránkou. Čítaj viac